Archive
Nonresident Supplemental Tuition (NRST) fellowship – a new program
Dear Graduate Program Chairs,
Nonresident supplemental tuition (NRST) for graduate students has been a persistent concern of faculty and the administration for many years. Although a number of policies have been adopted to mitigate the impact of NRST and the rate has not increased for 10 years (except for a technical shift of a small amount from tuition to NRST in 2011-12), NRST remains an obstacle to achieving our aspirations for excellence in graduate education.
As you know, present UC policy is that nonresident doctoral students do not pay NRST for a period of three years after they advance to candidacy. As a next step to mitigate the NRST challenge, we will adopt a new policy for doctoral students who remain in candidacy beyond the three year waiver period. These students will be eligible to receive a non-competitive fellowship to offset the cost of NRST each quarter using new funding approved by Provost and Executive Vice Chancellor Ralph Hexter. The new policy will require a simple application in Spring Quarter for the following academic year with a request to approve the NRST fellowship for up to three quarters. The NRST fellowship may be renewed for a second year. The Major Professor and Program Chair or Graduate Adviser will be required to endorse the application. The goal of this policy is to ensure that students are able to complete their degrees in a timely manner based on academic, rather than financial, considerations.
This new program will be in effect for Fall Quarter 2013. Additional details and the application materials will be available in June. In the meantime, please share this announcement with faculty and students in your program.
Thank you,
Jeff Gibeling
Transgenic E. coli made to produce hydrocarbon fuels
Super cool work from researchers in the UK
Excerpt from “Bacteria churn out first ever petrol-like biofuel” by Rebecca Summers
To be used as a mainstream alternative to fossil fuels – desirable because biofuels are carbon-neutral over their lifetime – engines would have to be redesigned, or an extra processing step employed to convert the fuel into a more usable form.
To try to bypass that, John Love from the University of Exeter in the UK and colleagues took genes from the camphor tree, soil bacteria and blue-green algae and spliced them into DNA from Escherichia coli bacteria. When the modified E. coli were fed glucose, the enzymes they produced converted the sugar into fatty acids and then turned these into hydrocarbons that were chemically and structurally identical to those found in commercial fuel.
“We are biologically producing the fuel that the oil industry makes and sells,” says Love.
Biofuels are the most immediate, practical solution for mitigating dependence on fossil hydrocarbons, but current biofuels (alcohols and biodiesels) require significant downstream processing and are not fully compatible with modern, mass-market internal combustion engines. Rather, the ideal biofuels are structurally and chemically identical to the fossil fuels they seek to replace (i.e., aliphatic n- and iso-alkanes and -alkenes of various chain lengths). Here we report on production of such petroleum-replica hydrocarbons in Escherichia coli. The activity of the fatty acid (FA) reductase complex from Photorhabdus luminescens was coupled with aldehyde decarbonylase from Nostoc punctiforme to use free FAs as substrates for alkane biosynthesis. This combination of genes enabled rational alterations to hydrocarbon chain length (Cn) and the production of branched alkanes through upstream genetic and exogenous manipulations of the FA pool. Genetic components for targeted manipulation of the FA pool included expression of a thioesterase from Cinnamomum camphora (camphor) to alter alkane Cn and expression of the branched-chain α-keto acid dehydrogenase complex and β-keto acyl-acyl carrier protein synthase III from Bacillus subtilis to synthesize branched (iso-) alkanes. Rather than simply reconstituting existing metabolic routes to alkane production found in nature, these results demonstrate the ability to design and implement artificial molecular pathways for the production of renewable, industrially relevant fuel molecules.
It’s official, a real study confirms that vaccines are NOT linked to autism
The pseudo-scientific argument that vaccines cause autism is based on very poor science and questionable motives. A new study out of the Children’s Hospital Medical Center in Cincinnati, OH further confirms that there is no scientific basis for believing that vaccines are a causative factor in the development of autism. Unlike the “work” by the much maligned Andrew Wakefield, this study actually looks at a large enough group of children to draw meaningful conclusions. Vaccines do not cause autism, please get your children vaccinated. You are putting your child at risk, and not vaccinating your children is a major threat to public health.
Excerpts from:
“Number Of Early Childhood Vaccines Not Linked To Autism” by Jon Hamilton
The study offers a response to vaccine skeptics who have suggested that getting too many vaccines on one day or in the first two years of life may lead to autism, says Frank DeStefano, director of the Immunization Safety Office of the CDC.
To find out if that was happening, DeStefano led a team that compared the vaccine histories of about 250 children who had autism spectrum disorder with those of 750 typical kids. Specifically, the researchers looked at what scientists call antigens. An antigen is a substance in a vaccine that causes the body to produce antibodies, proteins that help fight off infections.
The team looked at medical records to see how many antigens each child received and whether that affected the risk of autism. The results, published in The Journal of Pediatrics, were unequivocal.
“The amount of antigens from vaccines received on one day of vaccination or in total during the first two years of life is not related to the development of autism spectrum disorder in children,” DeStefano says.
The Risk of Autism Is Not Increased by “Too Many Vaccines Too Soon”
Although scientific evidence suggests that vaccines do not cause autism, approximately one-third of parents continue to express concern that they do; nearly 1 in 10 parents refuse or delay vaccinations because they believe it is safer than following the Centers for Disease Control and Prevention’s (CDC) schedule (
http://www.cdc.gov/vaccines/parents/downloads/parent-ver-sch-0-6yrs.pdf
). A primary concern is the number of vaccines administered, both on a single day and cumulatively over the first 2 years of life. In a new study scheduled for publication in The Journal of Pediatrics, researchers concluded that there is no association between receiving “too many vaccines too soon” and autism.……
The researchers determined the total antigen numbers by adding the number of different antigens in all vaccines each child received in one day, as well as all vaccines each child received up to 2 years of age. The authors found that the total antigens from vaccines received by age 2 years, or the maximum number received on a single day, was the same between children with and without ASD. Furthermore, when comparing antigen numbers, no relationship was found when they evaluated the sub-categories of autistic disorder and ASD with regression.
Although the current routine childhood vaccine schedule contains more vaccines than the schedule in the late 1990s, the maximum number of antigens that a child could be exposed to by 2 years of age in 2013 is 315, compared with several thousand in the late 1990s. Because different types of vaccines contain varying amounts of antigens, this research acknowledged that merely counting the number of vaccines received does not adequately account for how different vaccines and vaccine combinations stimulate the immune system. For example, the older whole cell pertussis vaccine causes the production of about 3000 different antibodies, whereas the newer acellular pertussis vaccine causes the production of 6 or fewer different antibodies.
Researchers at GIT show spontaneous assembly of “proto-RNAs” in water
Really interesting work. Essentially shows that stacking interactions and hydrogen bonding of the nitrogenous bases is sufficient to form a “proto-RNA” filament. While far from being definitive proof of anything, this work certainly builds on and supports the RNA-world hypothesis for the origins of life. Very cool stuff, will update this post when more information becomes available.
Excerpt from “Molecules assemble in water, hint at origins of life” in e! Science News
Researchers at the Georgia Institute of Technology are exploring an alternate theory for the origin of RNA: they think the RNA bases may have evolved from a pair of molecules distinct from the bases we have today. This theory looks increasingly attractive, as the Georgia Tech group was able to achieve efficient, highly ordered self-assembly in water with small molecules that are similar to the bases of RNA. These “proto-RNA bases” spontaneously assemble into gene-length linear stacks, suggesting that the genes of life could have gotten started from these or similar molecules.
…
The discovery was made by a team of scientists led by Georgia Tech Professor Nicholas Hud, who has been trying for years to find simple molecules that will assemble in water and be capable of forming RNA or its ancestor. Hud’s group knew that they were on to something when they added a small chemical tail to a proto-RNA base and saw it spontaneously form linear assemblies with another proto-RNA base. In some cases, the results produced 18,000 nicely ordered, stacked molecules in one long structure.
…
Hud concedes that scientists may never be 100 percent sure what existed four billion years ago when a complex mixture of chemicals started to work together to start life. His next goal is to determine whether the proto-RNA bases can be linked by a backbone to form a polymer that could have functioned as a genetic material.
CGPSA’s Non-Resident Tuition Fee (NRTF) Forum 2/20/13 2PM International House
CGPSA’s Non-Resident Tuition Fee (NRTF) Forum
Are you a graduate student who is concerned about NRTF ?
Are you wondering about how it impacts you ?
Are you wondering about the CGPSA’s NRTF student petition and it’s outcome?
Are you a faculty who can’t hire international PhD students because of the high NRTF?
Get your questions answered regarding NRT issue by the panel of invited speakers:
Jeffery Gibeling, Dean of Graduate Studies
Kelly Ratliff, Associate Vice Chancellor, Budget and Institutional Analysis
Rachael Goodhue, Chair of Graduate Council, Professor, Agricultural and Resource Economics
Ruth Asmundson, Former mayor of the City of Davis
Sarah Ligday, Lead International Student Advisor at SISS
When :
Date: Wednesday, February 20
Time: 2:00-3:30 pm
Location: International House
Refreshments will be provided !!
RSVP :
http://tinyurl.com/NRT-workshop
Hosted by :
Chancellor’s Graduate and Professional Advisory Board (CGPSA)
http://gradstudies.ucdavis.edu/about/cgpsa.html
Questions:
Please contact cgpsa.ucd@gmail.com
Base 3 vs Binary? Bioinform us all!
ATCGTAGACTATCAGAGACATCGA = 01011010110101010101101011101101101101011001010101101100110101 – electricity + magnet safe
In the timely publication in Nature, the field of synthetic genetics has accomplished in archiving Martin Luther King Jr’s “I have a dream” speech, along with a series of William Shakespeare’s sonnets, a pdf file, and a photograph of the lab that accomplished these feats into DNA, the code of all living organisms.
An excerpt of the article by Nick Collins of the Telegraph:
By translating computerised files into DNA similar to that found in plants and animals, the researchers claim it is possible to store a billion books’ worth of data for thousands of years in just a small test tube.
Although the method is expensive, it could still be much more efficient than hard drives or magnetic tape for long-term storage of large sets of data such as government records, the scientists said.
Within a decade, they expect the technique to have become cheap enough that DNA storage could become cost-efficient for the public to store lifelong keepsakes like wedding videos.
Dr Nick Goldman of the European Bioinformatics Institute, who led the study, said: “We already know that DNA is a robust way to store information because we can extract it from bones of woolly mammoths, which date back tens of thousands of years, and make sense of it.
“It’s also incredibly small, dense and does not need any power for storage, so shipping and keeping it is easy.”
Please find the entire article here
For those with access to academic journals, find the original scientific publication here, whom the lead author is Nick Goldman and the last author is Ewan Birney, both of which hail from the European Bioinformatics Institute (EBI).
For those who can’t access the journal article, the cost of this technology, according to the authors, is estimated to be $25,000 per megabyte of storage, and $220 to decode each megabyte. Keep in mind the cost of synthesizing DNA continues to decrease as this technology improves. Those who are interested in trends can take a peek at this plot, which gives the cost synthesis per base (nucleotide) over the past years. Remember, although the price costs cash money now (as with all initial technological infancies before they become commercial), DNA is a form information that is stable for thousands and thousands of years (we’re still trying to resurrect the mammoth, and BMCDB anticipates Jurassic Park 4 to be summer blockbuster in 2014), where conventional computer drives tend to degrade at a decade old, and that these drives are physically huge compared to the same amount of data that can be stored into DNA at a nanoscale – think of DNA as a penny and a computer drive as being the size of AT&T Park, the home of the 2012 World Series Champions, the San Francisco Giants.
BMCDB SSS 1/9/13 1PM LSA 1022: Annie Chiu Chromatin Remodeler RSF in Telomere Maintenance
This Wednesday
NEW TIME 1pm
1022 LSA
9 January 2013
Student Seminar Series presents
Annie Chiu
Chromatin Remodeler RSF in Telomere Maintenance
Free Pizza
Come down for science and lunch
Link to petition to stop the UC logo change
Have you seen the new UC logo? If you don’t like it, here’s a petition to stop the change:
http://www.change.org/petitions/university-of-california-stop-the-new-uc-logo
Funny poll on new UC logo on Knoepfler Lab Stem Cell blog
You might not be aware of it, but the University of California has created a new logo for itself. On the Knoepfler Lab Stem Cell blog there is a poll on how people perceive this new logo. At the time of this blog entry, the majority vote is: “Flushing Toilet”.
Flushing Toilet on the right? (Old logo on the left)
BMCDBer Rebecca Beer Gets 2nd in Aquaneering 2013 Art of Science Photomicrography Calendar Contest
Description of contest: 2013 Art of Science Photomicrography Calendar Contest
The earliest germ cells in the zebrafish ovary contain a population of germline stem cells. In this double transgenic adult zebrafish ovary imaged via fluorescent confocal microscopy, the ziwi promoter drives expression of mCherry in all germ cells (red) including early stage germ cells, while the vasa promoter drives expression of eGFP only in later stage oocytes (green), and DNA has been stained with DAPI (blue).
