Home > Recent News > Base 3 vs Binary? Bioinform us all!

Base 3 vs Binary? Bioinform us all!

ATCGTAGACTATCAGAGACATCGA = 01011010110101010101101011101101101101011001010101101100110101 – electricity + magnet safe

In the timely publication in Nature, the field of synthetic genetics has accomplished in archiving Martin Luther King Jr’s “I have a dream” speech, along with a series of William Shakespeare’s sonnets, a pdf file, and a photograph of the lab that accomplished these feats into DNA, the code of all living organisms.

An excerpt of the article by Nick Collins of the Telegraph:

By translating computerised files into DNA similar to that found in plants and animals, the researchers claim it is possible to store a billion books’ worth of data for thousands of years in just a small test tube.
Although the method is expensive, it could still be much more efficient than hard drives or magnetic tape for long-term storage of large sets of data such as government records, the scientists said.
Within a decade, they expect the technique to have become cheap enough that DNA storage could become cost-efficient for the public to store lifelong keepsakes like wedding videos.
Dr Nick Goldman of the European Bioinformatics Institute, who led the study, said: “We already know that DNA is a robust way to store information because we can extract it from bones of woolly mammoths, which date back tens of thousands of years, and make sense of it.
“It’s also incredibly small, dense and does not need any power for storage, so shipping and keeping it is easy.”

Please find the entire article here

For those with access to academic journals, find the original scientific publication here, whom the lead author is Nick Goldman and the last author is Ewan Birney, both of which hail from the European Bioinformatics Institute (EBI).

For those who can’t access the journal article, the cost of this technology, according to the authors, is estimated to be $25,000 per megabyte of storage, and $220 to decode each megabyte. Keep in mind the cost of synthesizing DNA continues to decrease as this technology improves. Those who are interested in trends can take a peek at this plot, which gives the cost synthesis per base (nucleotide) over the past years. Remember, although the price costs cash money now (as with all initial technological infancies before they become commercial), DNA is a form information that is stable for thousands and thousands of years (we’re still trying to resurrect the mammoth, and BMCDB anticipates Jurassic Park 4 to be summer blockbuster in 2014), where conventional computer drives tend to degrade at a decade old, and that these drives are physically huge compared to the same amount of data that can be stored into DNA at a nanoscale – think of DNA as a penny and a computer drive as being the size of AT&T Park, the home of the 2012 World Series Champions, the San Francisco Giants.

Categories: Recent News
  1. No comments yet.
  1. No trackbacks yet.

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out / Change )

Twitter picture

You are commenting using your Twitter account. Log Out / Change )

Facebook photo

You are commenting using your Facebook account. Log Out / Change )

Google+ photo

You are commenting using your Google+ account. Log Out / Change )

Connecting to %s

%d bloggers like this: